Review



2012 n a recombinant dna pmd2 g addgene  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 98
      Buy from Supplier

    Structured Review

    Addgene inc 2012 n a recombinant dna pmd2 g addgene
    2012 N A Recombinant Dna Pmd2 G Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 14770 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2012+addgene+plasmid/pMD2%2EG+(Plasmid+%2312259)/pm39562742-241-43-48
    Average 98 stars, based on 14770 article reviews
    2012 n a recombinant dna pmd2 g addgene - by Bioz Stars, 2026-09
    98/100 stars

    Images

    Related Articles

    other:

    Article Title: Combined Omics Approaches Reveal the Roles of Non-canonical WNT7B Signaling and YY1 in the Proliferation of Human Pancreatic Progenitor Cells.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LDN193189 Fujifilm Wako Chemicals Cat# 124-06011 TTNPB Santa Cruz Biotechnology Cat# sc-203303 SANT1 Sigma-Aldrich Cat# S4572 EGF R&D Cat# 236-EG Nicotinamide STEMCELL Technologies Cat# 07154 AT7867 Selleck Chemicals Cat# S1558 ALK5 inhibitor II Fujifilm Wako Chemicals Cat# 018-23023 Triiodothyronine Sigma-Aldrich Cat# 64245 RO4929097 Selleck Chemicals Cat# S1575 Retinoic acid Sigma-Aldrich Cat# R2625 TPB Santa Cruz Biotechnology Cat# sc-204424 Go6976 Fujifilm Wako Chemicals Cat# 071-06551 Cyclosporin A Nacalai Tesque Cat# 12281-44 LY294002 R&D Cat# 1130 Recombinant mouse Wnt3a StemRD Cat# W3A-M Recombinant human WNT7B Abnova Cat# H00007477-P01 iTRAQ Reagents Multiplex Kit Sciex Cat# 4352135 Hoechst 33342 Thermo Fisher Scientific Cat# H3570 Critical Commercial Assays TCF/LEF Reporter Kit BPS Bioscience Cat# 60500 Dual Luciferase Assay System BPS Bioscience Cat# 60683-1 Click-iT Plus EdU Pacific Blue Flow Cytometry Assay Kit Thermo Fisher Scientific Cat# C10636 FxCycle PI/RNase Staining Solution Thermo Fisher Scientific Cat# F10797 TruSeq Stranded mRNA LT Sample Prep Kit illumina Cat# RS-122-2101 RNeasy Mini Kit QIAGEN Cat# 74106 12-230 kDa Wes Separation Module Protein Simple Cat# SM-W002A, SM-W004A Pierce Albumin/IgG Removal Kit Thermo Fisher Scientific Cat# 89875 Deposited Data mRNA sequencing This paper GSE153806 Proteome data This paper JPST000774 (PXD018221), JPST000772 (PXD018222) Experimental Models: Cell Lines 585A1 Okita et al., 2013 N/A KhES3 Suemori et al., 2006 N/A Ff-I01 Nakagawa et al., 2014 N/A 1383D6 Nakagawa et al., 2014 N/A NIH3T3-LacZ/Wnt1/Wnt3a/Wnt4/Wnt5a/Wnt7a/ Wnt7b/Wnt11 Kispert et al., 1998 N/A TOM2B clone 6 Omura et al., 2009 N/A MEF-484x805 Omura et al., 2009 N/A HEK293 ATCC CRL-1573 Experimental Models: Organisms/Strains Slc:ICR SLC Japan N/A Oligonucleotides siRNAs, see Table S1 This paper N/A Primers for qPCR, see Table S2 This paper N/A Recombinant DNA pcDNA-WNT7A Najdi et al., 2012 Addgene Plasmid #35914 pcDNA-WNT7B Najdi et al., 2012 Addgene Plasmid #35915 (Continued on next page) e2 Cell Chemical Biology 27, 1–12.e1–e7, December 17, 2020

    Article Title: Severe deficiency of the voltage-gated sodium channel Na V 1.2 elevates neuronal excitability in adult mice.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER 10 3 Tris Buffered Saline Bio-Rad 1706435 10 3 Tris/Glycine Buffer Bio-Rad 1610771 10 3 Tris/Glycine/SDS Electrophoresis Buffer Bio-Rad 1610772 Immobilon -FL PVDF membrane Millipore IPFL00010 50 3 pH 8,3 tris-acetate EDTA buffer Millipore 1.06174 a-Dendrotoxin Alomone Labs D-350 Tetrodotoxin citrate Alomone Labs T-550 Picrotoxin Alomone Labs P-325 Optimal Cutting Temperature compound Tissue Tek 4583 NucleoSpin DNA RapidLyse Macherey-Nagel 740100.250 Liquid Proteinase K Macherey-Nagel 740396 Critical commercial assays b-Gal Staining Set Sigma-Aldrich 11828673001 Maxima First Strand cDNA Synthesis Kit for RT-qPCR, with dsDNase Thermo Fisher Scientific K1672 Deposited data Raw and processed RNA sequencing data This paper GEO: GSE179818 Custom scripts This paper Zenodo Repository https://zenodo. org/record/5098353 Experimental models: Organisms/strains Mouse: C57BL/6N-Scn2a1tm1aNarl/Narl The National Laboratory Animal Center Rodent Model Resource Center Scn2aWT/gt Oligonucleotides See Table S1 N/A Recombinant DNA pAAV-EF1a-mCherry-IRES-Flpo Fenno et al., 2014 Addgene Plasmid # 55634 pUCmini-iCAP-PHP.eB Chan et al., 2017 Addgene plasmid # 103005 pAAV-Ef1a-DO-mCherry-WPRE-pA Saunders et al., 2012 Addgene plasmid # 37119 Software and algorithms ImageJ (Fiji) Eliceiri/LOCI group https://fiji.sc/ Image Studio Lite 5.2 LI-COR Biosciences https://www.licor.com/bio/image-studio-lite/d5 pClamp 11.1 Molecular Devices https://www.moleculardevices.com/ products/axon-patch-clamp-system OriginPro version 2020 OriginLab Corporation https://www.originlab.com/ GraphPad Prism version 8.0.0 for Windows GraphPad Software https://www.graphpad.com/ Adobe Illustrator 2020 Adobe https://www.adobe.com/ Other Odyssey CLx Imaging System LI-COR Biosciences https://www.licor.com/bio/odyssey-clx/ NanoDrop OneC Microvolume UV-Vis Spectrophotometer Thermo Fisher Scientific N/A C1000 Touch PCR thermal cycler Bio-Rad N/A MultiPhoton confocal microscopy Nikon A1R-MP LSM 900 scanning confocal microscope Zeiss N/A Cryostat Leica Biosystems CM1950 Vibrating blade microtome Leica Biosystems VT1200 S Micropipette Puller Sutter Instrument P-1000 Borosilicate glass with filament Sutter Instrument BF150-110-10 Axon MultiClamp 700B Microelectrode Amplifier Molecular Devices N/A Axon Digidata 1550B Plus HumSilencer Molecular Devices Digidata 1550B4 (Continued on next page) Cell Reports 36, 109495, August 3, 2021 e2

    Protease Inhibitor:

    Article Title: Clathrin packets move in slow axonal transport and deliver functional payloads to synapses.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-Clathrin heavy chain antibody Abcam Cat#ab21679; RRID:AB_2083165 Chicken polyclonal anti-GFP antibody Abcam Cat#ab13970; RRID:AB_300798 Anti-rabbit Alexa Fluor 594 Invitrogen Cat#A11037; RRID:AB_2534095 Anti-Chicken Alexa Fluor 488 Invitrogen Cat#A11039; RRID:AB_142924 polyclonal chicken anti-Map2 Abcam Cat# ab5392; RRID:AB_2138153 monoclonal mouse anti b2-spectrin BD Bioscience Cat#612563; RRID:AB_399854 Anti-Clathrin mouse monoclonal antibody Affinity Bioreagents Cat#MA1-065; RRID:AB_2083179 Anti-Mouse IgG Abcam Cat#ab190475; RRID:AB_2827162 monoclonal mouse anti-synapsin Synaptic Systems Cat#106-001; RRID:AB_887805 Anti-rabbit D2 (Ultivue Kit) Ultivue Cat#Ultivue-2 Anti-mouse D2 (Ultivue Kit) Ultivue Cat#Ultivue-2 Chemicals, peptides, and recombinant proteins Dynasore Abcam Cat#ab120192 Latrunculin A Life Technologies Cat#L12370 Nocodazole Millipore-Sigma Cat#487928-10MG Swinholide A Millipore-Sigma Cat#574776-10UG A/C heterodimerizer Takara Cat#635056 FM4-64 Invitrogen Cat#T13320 Advasep-7 Millipore-Sigma Cat#A3723 HBSS GIBCO Cat#14025092 6-cyano-7-nitroquinoxaline-2,3dione CNQX Tocris Biosciences Cat#1045 D,L-2-amino-5-phosphonovaleric acid AP5 Tocris Biosciences Cat#106 VER155008 Tocris Biosciences Cat#3803 Lipofectamine 2000 Life Technologies Cat#11668-019 ProFection Mammalian Transfection System Promega Cat#E1200 B27 supplement GIBCO Cat#17504044 Glutamax GIBCO Cat#35050061 Neurobasal A GIBCO Cat#10888022 poly-D-lysine Sigma Cat#P0899 Hibernate-E low fluorescence medium Brainbits Cat#HE-lf 0.25% Trypsin–EDTA Invitrogen Cat#25200072 Fetal bovine serum Hyclone Cat#SH30071.03 Hemin chloride Millipore-Sigma Cat#3741 Sodium cacodylate trihydrate Millipore-Sigma Cat#C4945 Diaminobenzidine (DAB) Millipore-Sigma Cat#D8001 Osmium Tetraoxide (4% aqueous solution) Electron Microscopy Sciences Cat#19150 Paraformaldehyde (16% aqueous solution) Electron Microscopy Sciences Cat#15710 Glutaraldehyde (25% aqueous solution) Electron Microscopy Sciences Cat#16220 Durcupan ACM, Epoxy Resin (Kit) Electron Microscopy Sciences Cat#14040 Tris (2-carboxyethyl) phosphine hydrochloride Sigma-Aldrich Cat# 75259 (Continued on next page) e1 Neuron 109, 2884–2901.e1–e7, September 15, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Iodo-acetamide Sigma-Aldrich Cat#144-48-9 Protease inhibitor cocktail Sigma-Aldrich Cat#P8340 Dynabeads Co-Immunoprecipitation Kit ThermoFisher Scientific Cat#14321D 1.4 nm Nanogold secondary antibody Nanoprobes Cat#2001 HQ silver enhancement kit Nanoprobes Cat#2012-45ML Critical commercial assays Live-or-Dye NucFix Red Biotium Cat#32010-T Deposited data Proteomics Data This Paper; ProteomeXchange Consortium (PRIDE database) (Perez-Riverol et al., 2016) Table S1; PXD027857 (https://www.ebi.ac. uk/pride/) Experimental models: Organisms/strains Mouse: CD1 Charles River Laboratories Cat#022-CD1 Recombinant DNA GFP:CLC Gaidarov et al.,1999 N/A pUC57-APEX Martell et al., 2012 Addgene Plasmid #40306 Dendra2-Lifeact-7 Dendra2-Lifeact-7 was a gift from Michael Davidson Addgene plasmid #54694 Dendra2:CLC This paper N/A PAGFP-C1 Patterson and Lippincott- Schwartz, 2002 Addgene plasmid #11910 PAGFP:CLC This paper N/A CHC-T7-Hub Liu et al., 1998 N/A T7-empty backbone Liu et al., 1998 N/A GFP:Utr-CH Burkel et al., 2007 Addgene Plasmid #26737 synaptophysin:mCh Gerrow et al., 2006 N/A pBa-Flag-BicD2-FKBP Bentley et al., 2015 Addgene Plasmid #64206 pBa- Flag-tdTM-BicD2-FKBP Bentley et al., 2015 Addgene Plasmid #64205 pBa-FRB-3myc-Rab5a Bentley et al., 2015 Addgene Plasmid #64209 FRB-GFP:CLC This paper N/A GFP:synapsin-1a Gitler et al., 2004 N/A EGFP-AP180 Bushlin et al., 2008 N/A GAK-GFP Massol et al., 2006 N/A pEGFP-C1-Dynamin Song et al., 2004 Addgene Plasmid #34680 CLC:mCherry This paper N/A pEGFP-N1 Clonetech Cat#6085-1 Software and algorithms GraphPad Prism GraphPad Software, La Jolla, CA, USA Version 7.00; www.graphpad.com; RRID:SCR_002798 Fiji ImageJ Schindelin et al., 2012 https://imagej.net/Fiji; RRID:SCR_002285 MetaMorph Version 7.10 Molecular Devices https://www.moleculardevices.com/ products/cellular-imaging-systems/ acquisition-and-analysis-software/ metamorph-microscopy; RRID:SCR_002368 Adobe Illustrator Adobe https://www.adobe.com/products/ illustrator/free-trial-download.html; RRID:SCR_010279 RawXtract version 1.9.9 McDonald et al., 2004 http://fields.scripps.edu/downloads.php (Continued on next page) Neuron 109, 2884–2901.e1–e7, September 15, 2021 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER N-STORM software Nikon; Jungmann et al., 2014 https:// www.microscope.healthcare.nikon.com/ products/super-resolution-microscopes/nstorm-super-resolution; RRID:SCR_018302 ChimeraX software Goddard et al., 2018 https://www.rbvi.ucsf.edu/chimerax/; RRID:SCR_015872 ThunderSTORM Jimenez et al., 2020 https://github.com/zitmen/thunderstorm; RRID:SCR_016897

    Recombinant:

    Article Title: Clathrin packets move in slow axonal transport and deliver functional payloads to synapses.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-Clathrin heavy chain antibody Abcam Cat#ab21679; RRID:AB_2083165 Chicken polyclonal anti-GFP antibody Abcam Cat#ab13970; RRID:AB_300798 Anti-rabbit Alexa Fluor 594 Invitrogen Cat#A11037; RRID:AB_2534095 Anti-Chicken Alexa Fluor 488 Invitrogen Cat#A11039; RRID:AB_142924 polyclonal chicken anti-Map2 Abcam Cat# ab5392; RRID:AB_2138153 monoclonal mouse anti b2-spectrin BD Bioscience Cat#612563; RRID:AB_399854 Anti-Clathrin mouse monoclonal antibody Affinity Bioreagents Cat#MA1-065; RRID:AB_2083179 Anti-Mouse IgG Abcam Cat#ab190475; RRID:AB_2827162 monoclonal mouse anti-synapsin Synaptic Systems Cat#106-001; RRID:AB_887805 Anti-rabbit D2 (Ultivue Kit) Ultivue Cat#Ultivue-2 Anti-mouse D2 (Ultivue Kit) Ultivue Cat#Ultivue-2 Chemicals, peptides, and recombinant proteins Dynasore Abcam Cat#ab120192 Latrunculin A Life Technologies Cat#L12370 Nocodazole Millipore-Sigma Cat#487928-10MG Swinholide A Millipore-Sigma Cat#574776-10UG A/C heterodimerizer Takara Cat#635056 FM4-64 Invitrogen Cat#T13320 Advasep-7 Millipore-Sigma Cat#A3723 HBSS GIBCO Cat#14025092 6-cyano-7-nitroquinoxaline-2,3dione CNQX Tocris Biosciences Cat#1045 D,L-2-amino-5-phosphonovaleric acid AP5 Tocris Biosciences Cat#106 VER155008 Tocris Biosciences Cat#3803 Lipofectamine 2000 Life Technologies Cat#11668-019 ProFection Mammalian Transfection System Promega Cat#E1200 B27 supplement GIBCO Cat#17504044 Glutamax GIBCO Cat#35050061 Neurobasal A GIBCO Cat#10888022 poly-D-lysine Sigma Cat#P0899 Hibernate-E low fluorescence medium Brainbits Cat#HE-lf 0.25% Trypsin–EDTA Invitrogen Cat#25200072 Fetal bovine serum Hyclone Cat#SH30071.03 Hemin chloride Millipore-Sigma Cat#3741 Sodium cacodylate trihydrate Millipore-Sigma Cat#C4945 Diaminobenzidine (DAB) Millipore-Sigma Cat#D8001 Osmium Tetraoxide (4% aqueous solution) Electron Microscopy Sciences Cat#19150 Paraformaldehyde (16% aqueous solution) Electron Microscopy Sciences Cat#15710 Glutaraldehyde (25% aqueous solution) Electron Microscopy Sciences Cat#16220 Durcupan ACM, Epoxy Resin (Kit) Electron Microscopy Sciences Cat#14040 Tris (2-carboxyethyl) phosphine hydrochloride Sigma-Aldrich Cat# 75259 (Continued on next page) e1 Neuron 109, 2884–2901.e1–e7, September 15, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Iodo-acetamide Sigma-Aldrich Cat#144-48-9 Protease inhibitor cocktail Sigma-Aldrich Cat#P8340 Dynabeads Co-Immunoprecipitation Kit ThermoFisher Scientific Cat#14321D 1.4 nm Nanogold secondary antibody Nanoprobes Cat#2001 HQ silver enhancement kit Nanoprobes Cat#2012-45ML Critical commercial assays Live-or-Dye NucFix Red Biotium Cat#32010-T Deposited data Proteomics Data This Paper; ProteomeXchange Consortium (PRIDE database) (Perez-Riverol et al., 2016) Table S1; PXD027857 (https://www.ebi.ac. uk/pride/) Experimental models: Organisms/strains Mouse: CD1 Charles River Laboratories Cat#022-CD1 Recombinant DNA GFP:CLC Gaidarov et al.,1999 N/A pUC57-APEX Martell et al., 2012 Addgene Plasmid #40306 Dendra2-Lifeact-7 Dendra2-Lifeact-7 was a gift from Michael Davidson Addgene plasmid #54694 Dendra2:CLC This paper N/A PAGFP-C1 Patterson and Lippincott- Schwartz, 2002 Addgene plasmid #11910 PAGFP:CLC This paper N/A CHC-T7-Hub Liu et al., 1998 N/A T7-empty backbone Liu et al., 1998 N/A GFP:Utr-CH Burkel et al., 2007 Addgene Plasmid #26737 synaptophysin:mCh Gerrow et al., 2006 N/A pBa-Flag-BicD2-FKBP Bentley et al., 2015 Addgene Plasmid #64206 pBa- Flag-tdTM-BicD2-FKBP Bentley et al., 2015 Addgene Plasmid #64205 pBa-FRB-3myc-Rab5a Bentley et al., 2015 Addgene Plasmid #64209 FRB-GFP:CLC This paper N/A GFP:synapsin-1a Gitler et al., 2004 N/A EGFP-AP180 Bushlin et al., 2008 N/A GAK-GFP Massol et al., 2006 N/A pEGFP-C1-Dynamin Song et al., 2004 Addgene Plasmid #34680 CLC:mCherry This paper N/A pEGFP-N1 Clonetech Cat#6085-1 Software and algorithms GraphPad Prism GraphPad Software, La Jolla, CA, USA Version 7.00; www.graphpad.com; RRID:SCR_002798 Fiji ImageJ Schindelin et al., 2012 https://imagej.net/Fiji; RRID:SCR_002285 MetaMorph Version 7.10 Molecular Devices https://www.moleculardevices.com/ products/cellular-imaging-systems/ acquisition-and-analysis-software/ metamorph-microscopy; RRID:SCR_002368 Adobe Illustrator Adobe https://www.adobe.com/products/ illustrator/free-trial-download.html; RRID:SCR_010279 RawXtract version 1.9.9 McDonald et al., 2004 http://fields.scripps.edu/downloads.php (Continued on next page) Neuron 109, 2884–2901.e1–e7, September 15, 2021 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER N-STORM software Nikon; Jungmann et al., 2014 https:// www.microscope.healthcare.nikon.com/ products/super-resolution-microscopes/nstorm-super-resolution; RRID:SCR_018302 ChimeraX software Goddard et al., 2018 https://www.rbvi.ucsf.edu/chimerax/; RRID:SCR_015872 ThunderSTORM Jimenez et al., 2020 https://github.com/zitmen/thunderstorm; RRID:SCR_016897

    Article Title: OTUB1 Is a Key Regulator of RIG-I-Dependent Immune Signaling and Is Targeted for Proteasomal Degradation by Influenza A NS1.
    Article Snippet: .. A549 OTUB1 / This study N/A A549 Myc-birA-OTUB1 This study N/A A549 OTUB1ovrexp This study N/A A549 HA-birA- OTUB1 This study N/A Primary human lung epithelial cells ATCC PCS-301-010 Oligonucleotides GGGCTTCACTGAATTCACAA (sgRNA) This study N/A Recombinant DNA pSpCas9(BB)-2A-Puro (PX459) V2.0 Garcı́a-Sastre et al., 1998 Addgene plasmid # 62988) OTUB1-PX459 This study N/A pcDNA3.1 mycBio-ID Roux et al., 2012 Addgene plasmid #36047 pcDNA3.1 MCS-BirA(R118G)-HA Roux et al., 2012 Addgene plasmid #36047 BirA-OTUB1-HA This study N/A BirA-OTUB1-MYC This study N/A OTUB1 (C91S) This study N/A OTUB1 (D88A) This study N/A OTUB1 (S16A) This study N/A OTUB1 (S16E) This study N/A Myc-tagged RIG-I Te Velthuis et al., 2018 N/A OTUB1-pOPINK Addgene Addgene plasmid #61420) OTUB1*-pOPINB Addgene Addgene plasmid #65441) pLenti6/V5-OTUB1 This study N/A pLenti6/V5-DEST Zhang et al., 2018a Thermofisher plasmid # V49610 NS1 A/Puerto Rico/8/34 (PR/34) Hale et al., 2010 N/A (Continued on next page) e2 Cell Reports 30, 1570–1584.e1–e6, February 4, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER NS1 A/California/04/09 NS1 (Cal/09) Hale et al., 2010 N/A Strep-PB2 (from H1N1 WSN, H1N1 pdm09, H3N2) Biquand et al., 2017 N/A pRK5-HA-Ubiquitin-K48 Addgene Addgene Plasmid 17605 HA-ub-K63 Addgene Addgene Plasmid 17606 HA-ubiquitin Addgene Addgene Plasmid 18712 Software and Algorithms Prism 8.0 GraphPad Software https://www.graphpad.com/scientific- software/prism/ ImageJ NIH https://imagej.net/ImageJ ZEN confocal software Zeiss https://imagej.net/Fiji CRISPR RGEN Tool Cas-OFFinder Cas-OFFinder http://www.rgenome.net/cas-offinder RStudio 1.2.5001 RStudio, Inc https://rstudio.com Ingenuity Pathway Analysis software QIAGEN https://www.qiagenbioinformatics.com/ products/ingenuity-pathway-analysis/


    Plasmid Preparation:

    Article Title: Clathrin packets move in slow axonal transport and deliver functional payloads to synapses.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-Clathrin heavy chain antibody Abcam Cat#ab21679; RRID:AB_2083165 Chicken polyclonal anti-GFP antibody Abcam Cat#ab13970; RRID:AB_300798 Anti-rabbit Alexa Fluor 594 Invitrogen Cat#A11037; RRID:AB_2534095 Anti-Chicken Alexa Fluor 488 Invitrogen Cat#A11039; RRID:AB_142924 polyclonal chicken anti-Map2 Abcam Cat# ab5392; RRID:AB_2138153 monoclonal mouse anti b2-spectrin BD Bioscience Cat#612563; RRID:AB_399854 Anti-Clathrin mouse monoclonal antibody Affinity Bioreagents Cat#MA1-065; RRID:AB_2083179 Anti-Mouse IgG Abcam Cat#ab190475; RRID:AB_2827162 monoclonal mouse anti-synapsin Synaptic Systems Cat#106-001; RRID:AB_887805 Anti-rabbit D2 (Ultivue Kit) Ultivue Cat#Ultivue-2 Anti-mouse D2 (Ultivue Kit) Ultivue Cat#Ultivue-2 Chemicals, peptides, and recombinant proteins Dynasore Abcam Cat#ab120192 Latrunculin A Life Technologies Cat#L12370 Nocodazole Millipore-Sigma Cat#487928-10MG Swinholide A Millipore-Sigma Cat#574776-10UG A/C heterodimerizer Takara Cat#635056 FM4-64 Invitrogen Cat#T13320 Advasep-7 Millipore-Sigma Cat#A3723 HBSS GIBCO Cat#14025092 6-cyano-7-nitroquinoxaline-2,3dione CNQX Tocris Biosciences Cat#1045 D,L-2-amino-5-phosphonovaleric acid AP5 Tocris Biosciences Cat#106 VER155008 Tocris Biosciences Cat#3803 Lipofectamine 2000 Life Technologies Cat#11668-019 ProFection Mammalian Transfection System Promega Cat#E1200 B27 supplement GIBCO Cat#17504044 Glutamax GIBCO Cat#35050061 Neurobasal A GIBCO Cat#10888022 poly-D-lysine Sigma Cat#P0899 Hibernate-E low fluorescence medium Brainbits Cat#HE-lf 0.25% Trypsin–EDTA Invitrogen Cat#25200072 Fetal bovine serum Hyclone Cat#SH30071.03 Hemin chloride Millipore-Sigma Cat#3741 Sodium cacodylate trihydrate Millipore-Sigma Cat#C4945 Diaminobenzidine (DAB) Millipore-Sigma Cat#D8001 Osmium Tetraoxide (4% aqueous solution) Electron Microscopy Sciences Cat#19150 Paraformaldehyde (16% aqueous solution) Electron Microscopy Sciences Cat#15710 Glutaraldehyde (25% aqueous solution) Electron Microscopy Sciences Cat#16220 Durcupan ACM, Epoxy Resin (Kit) Electron Microscopy Sciences Cat#14040 Tris (2-carboxyethyl) phosphine hydrochloride Sigma-Aldrich Cat# 75259 (Continued on next page) e1 Neuron 109, 2884–2901.e1–e7, September 15, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Iodo-acetamide Sigma-Aldrich Cat#144-48-9 Protease inhibitor cocktail Sigma-Aldrich Cat#P8340 Dynabeads Co-Immunoprecipitation Kit ThermoFisher Scientific Cat#14321D 1.4 nm Nanogold secondary antibody Nanoprobes Cat#2001 HQ silver enhancement kit Nanoprobes Cat#2012-45ML Critical commercial assays Live-or-Dye NucFix Red Biotium Cat#32010-T Deposited data Proteomics Data This Paper; ProteomeXchange Consortium (PRIDE database) (Perez-Riverol et al., 2016) Table S1; PXD027857 (https://www.ebi.ac. uk/pride/) Experimental models: Organisms/strains Mouse: CD1 Charles River Laboratories Cat#022-CD1 Recombinant DNA GFP:CLC Gaidarov et al.,1999 N/A pUC57-APEX Martell et al., 2012 Addgene Plasmid #40306 Dendra2-Lifeact-7 Dendra2-Lifeact-7 was a gift from Michael Davidson Addgene plasmid #54694 Dendra2:CLC This paper N/A PAGFP-C1 Patterson and Lippincott- Schwartz, 2002 Addgene plasmid #11910 PAGFP:CLC This paper N/A CHC-T7-Hub Liu et al., 1998 N/A T7-empty backbone Liu et al., 1998 N/A GFP:Utr-CH Burkel et al., 2007 Addgene Plasmid #26737 synaptophysin:mCh Gerrow et al., 2006 N/A pBa-Flag-BicD2-FKBP Bentley et al., 2015 Addgene Plasmid #64206 pBa- Flag-tdTM-BicD2-FKBP Bentley et al., 2015 Addgene Plasmid #64205 pBa-FRB-3myc-Rab5a Bentley et al., 2015 Addgene Plasmid #64209 FRB-GFP:CLC This paper N/A GFP:synapsin-1a Gitler et al., 2004 N/A EGFP-AP180 Bushlin et al., 2008 N/A GAK-GFP Massol et al., 2006 N/A pEGFP-C1-Dynamin Song et al., 2004 Addgene Plasmid #34680 CLC:mCherry This paper N/A pEGFP-N1 Clonetech Cat#6085-1 Software and algorithms GraphPad Prism GraphPad Software, La Jolla, CA, USA Version 7.00; www.graphpad.com; RRID:SCR_002798 Fiji ImageJ Schindelin et al., 2012 https://imagej.net/Fiji; RRID:SCR_002285 MetaMorph Version 7.10 Molecular Devices https://www.moleculardevices.com/ products/cellular-imaging-systems/ acquisition-and-analysis-software/ metamorph-microscopy; RRID:SCR_002368 Adobe Illustrator Adobe https://www.adobe.com/products/ illustrator/free-trial-download.html; RRID:SCR_010279 RawXtract version 1.9.9 McDonald et al., 2004 http://fields.scripps.edu/downloads.php (Continued on next page) Neuron 109, 2884–2901.e1–e7, September 15, 2021 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER N-STORM software Nikon; Jungmann et al., 2014 https:// www.microscope.healthcare.nikon.com/ products/super-resolution-microscopes/nstorm-super-resolution; RRID:SCR_018302 ChimeraX software Goddard et al., 2018 https://www.rbvi.ucsf.edu/chimerax/; RRID:SCR_015872 ThunderSTORM Jimenez et al., 2020 https://github.com/zitmen/thunderstorm; RRID:SCR_016897

    Article Title: OTUB1 Is a Key Regulator of RIG-I-Dependent Immune Signaling and Is Targeted for Proteasomal Degradation by Influenza A NS1.
    Article Snippet: .. A549 OTUB1 / This study N/A A549 Myc-birA-OTUB1 This study N/A A549 OTUB1ovrexp This study N/A A549 HA-birA- OTUB1 This study N/A Primary human lung epithelial cells ATCC PCS-301-010 Oligonucleotides GGGCTTCACTGAATTCACAA (sgRNA) This study N/A Recombinant DNA pSpCas9(BB)-2A-Puro (PX459) V2.0 Garcı́a-Sastre et al., 1998 Addgene plasmid # 62988) OTUB1-PX459 This study N/A pcDNA3.1 mycBio-ID Roux et al., 2012 Addgene plasmid #36047 pcDNA3.1 MCS-BirA(R118G)-HA Roux et al., 2012 Addgene plasmid #36047 BirA-OTUB1-HA This study N/A BirA-OTUB1-MYC This study N/A OTUB1 (C91S) This study N/A OTUB1 (D88A) This study N/A OTUB1 (S16A) This study N/A OTUB1 (S16E) This study N/A Myc-tagged RIG-I Te Velthuis et al., 2018 N/A OTUB1-pOPINK Addgene Addgene plasmid #61420) OTUB1*-pOPINB Addgene Addgene plasmid #65441) pLenti6/V5-OTUB1 This study N/A pLenti6/V5-DEST Zhang et al., 2018a Thermofisher plasmid # V49610 NS1 A/Puerto Rico/8/34 (PR/34) Hale et al., 2010 N/A (Continued on next page) e2 Cell Reports 30, 1570–1584.e1–e6, February 4, 2020 .. REAGENT or RESOURCE SOURCE IDENTIFIER NS1 A/California/04/09 NS1 (Cal/09) Hale et al., 2010 N/A Strep-PB2 (from H1N1 WSN, H1N1 pdm09, H3N2) Biquand et al., 2017 N/A pRK5-HA-Ubiquitin-K48 Addgene Addgene Plasmid 17605 HA-ub-K63 Addgene Addgene Plasmid 17606 HA-ubiquitin Addgene Addgene Plasmid 18712 Software and Algorithms Prism 8.0 GraphPad Software https://www.graphpad.com/scientific- software/prism/ ImageJ NIH https://imagej.net/ImageJ ZEN confocal software Zeiss https://imagej.net/Fiji CRISPR RGEN Tool Cas-OFFinder Cas-OFFinder http://www.rgenome.net/cas-offinder RStudio 1.2.5001 RStudio, Inc https://rstudio.com Ingenuity Pathway Analysis software QIAGEN https://www.qiagenbioinformatics.com/ products/ingenuity-pathway-analysis/


    Article Title: Different translation dynamics of β- and γ-actin regulates cell migration
    Article Snippet: .. Transfected construct (synthetic) pHR-scFv-GCN4sfGFP-GB1-NLS-dWPRE Tanenbaum et al., 2014 Addgene plasmid # 60906 Plasmid containing Superfolder-GFP fused to single-chain variable fragment against GCN4 repeats used to localize nascent peptides from SINAPS constructs Transfected construct (synthetic) pBabe TIR1-9myc Holland et al., 2012 Addgene plasmid # 47328 Plasmid containing the ubiquitin ligase TIR, which targets auxin-induced degrons in nascent peptides from SINAPS constructs Continued on next page Vedula et al. eLife 2021;10:e68712. .. DOI: https://doi.org/10.7554/eLife.68712 16 of 25 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Antibody Anti-Paxillin (mouse monoclonal) BD Transduction Laboratories Cat#: 610619 IF (1:100) Recombinant DNA reagent eTC GFP beta-actin full length (plasmid) Rodriguez et al., 2006 Addgene plasmid # 27123 Human ACTB promoter and 30UTR containing plasmid with eGFP.

    Software:

    Article Title: Clathrin packets move in slow axonal transport and deliver functional payloads to synapses.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-Clathrin heavy chain antibody Abcam Cat#ab21679; RRID:AB_2083165 Chicken polyclonal anti-GFP antibody Abcam Cat#ab13970; RRID:AB_300798 Anti-rabbit Alexa Fluor 594 Invitrogen Cat#A11037; RRID:AB_2534095 Anti-Chicken Alexa Fluor 488 Invitrogen Cat#A11039; RRID:AB_142924 polyclonal chicken anti-Map2 Abcam Cat# ab5392; RRID:AB_2138153 monoclonal mouse anti b2-spectrin BD Bioscience Cat#612563; RRID:AB_399854 Anti-Clathrin mouse monoclonal antibody Affinity Bioreagents Cat#MA1-065; RRID:AB_2083179 Anti-Mouse IgG Abcam Cat#ab190475; RRID:AB_2827162 monoclonal mouse anti-synapsin Synaptic Systems Cat#106-001; RRID:AB_887805 Anti-rabbit D2 (Ultivue Kit) Ultivue Cat#Ultivue-2 Anti-mouse D2 (Ultivue Kit) Ultivue Cat#Ultivue-2 Chemicals, peptides, and recombinant proteins Dynasore Abcam Cat#ab120192 Latrunculin A Life Technologies Cat#L12370 Nocodazole Millipore-Sigma Cat#487928-10MG Swinholide A Millipore-Sigma Cat#574776-10UG A/C heterodimerizer Takara Cat#635056 FM4-64 Invitrogen Cat#T13320 Advasep-7 Millipore-Sigma Cat#A3723 HBSS GIBCO Cat#14025092 6-cyano-7-nitroquinoxaline-2,3dione CNQX Tocris Biosciences Cat#1045 D,L-2-amino-5-phosphonovaleric acid AP5 Tocris Biosciences Cat#106 VER155008 Tocris Biosciences Cat#3803 Lipofectamine 2000 Life Technologies Cat#11668-019 ProFection Mammalian Transfection System Promega Cat#E1200 B27 supplement GIBCO Cat#17504044 Glutamax GIBCO Cat#35050061 Neurobasal A GIBCO Cat#10888022 poly-D-lysine Sigma Cat#P0899 Hibernate-E low fluorescence medium Brainbits Cat#HE-lf 0.25% Trypsin–EDTA Invitrogen Cat#25200072 Fetal bovine serum Hyclone Cat#SH30071.03 Hemin chloride Millipore-Sigma Cat#3741 Sodium cacodylate trihydrate Millipore-Sigma Cat#C4945 Diaminobenzidine (DAB) Millipore-Sigma Cat#D8001 Osmium Tetraoxide (4% aqueous solution) Electron Microscopy Sciences Cat#19150 Paraformaldehyde (16% aqueous solution) Electron Microscopy Sciences Cat#15710 Glutaraldehyde (25% aqueous solution) Electron Microscopy Sciences Cat#16220 Durcupan ACM, Epoxy Resin (Kit) Electron Microscopy Sciences Cat#14040 Tris (2-carboxyethyl) phosphine hydrochloride Sigma-Aldrich Cat# 75259 (Continued on next page) e1 Neuron 109, 2884–2901.e1–e7, September 15, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Iodo-acetamide Sigma-Aldrich Cat#144-48-9 Protease inhibitor cocktail Sigma-Aldrich Cat#P8340 Dynabeads Co-Immunoprecipitation Kit ThermoFisher Scientific Cat#14321D 1.4 nm Nanogold secondary antibody Nanoprobes Cat#2001 HQ silver enhancement kit Nanoprobes Cat#2012-45ML Critical commercial assays Live-or-Dye NucFix Red Biotium Cat#32010-T Deposited data Proteomics Data This Paper; ProteomeXchange Consortium (PRIDE database) (Perez-Riverol et al., 2016) Table S1; PXD027857 (https://www.ebi.ac. uk/pride/) Experimental models: Organisms/strains Mouse: CD1 Charles River Laboratories Cat#022-CD1 Recombinant DNA GFP:CLC Gaidarov et al.,1999 N/A pUC57-APEX Martell et al., 2012 Addgene Plasmid #40306 Dendra2-Lifeact-7 Dendra2-Lifeact-7 was a gift from Michael Davidson Addgene plasmid #54694 Dendra2:CLC This paper N/A PAGFP-C1 Patterson and Lippincott- Schwartz, 2002 Addgene plasmid #11910 PAGFP:CLC This paper N/A CHC-T7-Hub Liu et al., 1998 N/A T7-empty backbone Liu et al., 1998 N/A GFP:Utr-CH Burkel et al., 2007 Addgene Plasmid #26737 synaptophysin:mCh Gerrow et al., 2006 N/A pBa-Flag-BicD2-FKBP Bentley et al., 2015 Addgene Plasmid #64206 pBa- Flag-tdTM-BicD2-FKBP Bentley et al., 2015 Addgene Plasmid #64205 pBa-FRB-3myc-Rab5a Bentley et al., 2015 Addgene Plasmid #64209 FRB-GFP:CLC This paper N/A GFP:synapsin-1a Gitler et al., 2004 N/A EGFP-AP180 Bushlin et al., 2008 N/A GAK-GFP Massol et al., 2006 N/A pEGFP-C1-Dynamin Song et al., 2004 Addgene Plasmid #34680 CLC:mCherry This paper N/A pEGFP-N1 Clonetech Cat#6085-1 Software and algorithms GraphPad Prism GraphPad Software, La Jolla, CA, USA Version 7.00; www.graphpad.com; RRID:SCR_002798 Fiji ImageJ Schindelin et al., 2012 https://imagej.net/Fiji; RRID:SCR_002285 MetaMorph Version 7.10 Molecular Devices https://www.moleculardevices.com/ products/cellular-imaging-systems/ acquisition-and-analysis-software/ metamorph-microscopy; RRID:SCR_002368 Adobe Illustrator Adobe https://www.adobe.com/products/ illustrator/free-trial-download.html; RRID:SCR_010279 RawXtract version 1.9.9 McDonald et al., 2004 http://fields.scripps.edu/downloads.php (Continued on next page) Neuron 109, 2884–2901.e1–e7, September 15, 2021 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER N-STORM software Nikon; Jungmann et al., 2014 https:// www.microscope.healthcare.nikon.com/ products/super-resolution-microscopes/nstorm-super-resolution; RRID:SCR_018302 ChimeraX software Goddard et al., 2018 https://www.rbvi.ucsf.edu/chimerax/; RRID:SCR_015872 ThunderSTORM Jimenez et al., 2020 https://github.com/zitmen/thunderstorm; RRID:SCR_016897


    Mutagenesis:


    Membrane:


    Cell Culture:


    Electroporation:


    Transfection:

    Article Title: Different translation dynamics of β- and γ-actin regulates cell migration
    Article Snippet: .. Transfected construct (synthetic) pHR-scFv-GCN4sfGFP-GB1-NLS-dWPRE Tanenbaum et al., 2014 Addgene plasmid # 60906 Plasmid containing Superfolder-GFP fused to single-chain variable fragment against GCN4 repeats used to localize nascent peptides from SINAPS constructs Transfected construct (synthetic) pBabe TIR1-9myc Holland et al., 2012 Addgene plasmid # 47328 Plasmid containing the ubiquitin ligase TIR, which targets auxin-induced degrons in nascent peptides from SINAPS constructs Continued on next page Vedula et al. eLife 2021;10:e68712. .. DOI: https://doi.org/10.7554/eLife.68712 16 of 25 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Antibody Anti-Paxillin (mouse monoclonal) BD Transduction Laboratories Cat#: 610619 IF (1:100) Recombinant DNA reagent eTC GFP beta-actin full length (plasmid) Rodriguez et al., 2006 Addgene plasmid # 27123 Human ACTB promoter and 30UTR containing plasmid with eGFP.

    Construct:

    Article Title: Different translation dynamics of β- and γ-actin regulates cell migration
    Article Snippet: .. Transfected construct (synthetic) pHR-scFv-GCN4sfGFP-GB1-NLS-dWPRE Tanenbaum et al., 2014 Addgene plasmid # 60906 Plasmid containing Superfolder-GFP fused to single-chain variable fragment against GCN4 repeats used to localize nascent peptides from SINAPS constructs Transfected construct (synthetic) pBabe TIR1-9myc Holland et al., 2012 Addgene plasmid # 47328 Plasmid containing the ubiquitin ligase TIR, which targets auxin-induced degrons in nascent peptides from SINAPS constructs Continued on next page Vedula et al. eLife 2021;10:e68712. .. DOI: https://doi.org/10.7554/eLife.68712 16 of 25 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Antibody Anti-Paxillin (mouse monoclonal) BD Transduction Laboratories Cat#: 610619 IF (1:100) Recombinant DNA reagent eTC GFP beta-actin full length (plasmid) Rodriguez et al., 2006 Addgene plasmid # 27123 Human ACTB promoter and 30UTR containing plasmid with eGFP.

    Ubiquitin Proteomics:

    Article Title: Different translation dynamics of β- and γ-actin regulates cell migration
    Article Snippet: .. Transfected construct (synthetic) pHR-scFv-GCN4sfGFP-GB1-NLS-dWPRE Tanenbaum et al., 2014 Addgene plasmid # 60906 Plasmid containing Superfolder-GFP fused to single-chain variable fragment against GCN4 repeats used to localize nascent peptides from SINAPS constructs Transfected construct (synthetic) pBabe TIR1-9myc Holland et al., 2012 Addgene plasmid # 47328 Plasmid containing the ubiquitin ligase TIR, which targets auxin-induced degrons in nascent peptides from SINAPS constructs Continued on next page Vedula et al. eLife 2021;10:e68712. .. DOI: https://doi.org/10.7554/eLife.68712 16 of 25 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Antibody Anti-Paxillin (mouse monoclonal) BD Transduction Laboratories Cat#: 610619 IF (1:100) Recombinant DNA reagent eTC GFP beta-actin full length (plasmid) Rodriguez et al., 2006 Addgene plasmid # 27123 Human ACTB promoter and 30UTR containing plasmid with eGFP.



    Similar Products

    2012 n a recombinant dna pmd2 g addgene  (Addgene inc)
    98
    Addgene inc 2012 n a recombinant dna pmd2 g addgene
    2012 N A Recombinant Dna Pmd2 G Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2012+addgene+plasmid/pMD2%2EG+(Plasmid+%2312259)/pm39562742-241-43-48
    Average 98 stars, based on 1 article reviews
    2012 n a recombinant dna pmd2 g addgene - by Bioz Stars, 2026-09
    98/100 stars
    		  Buy from Supplier
    j cell 2012 11 001 addgene  (Addgene inc)
    92
    Addgene inc j cell 2012 11 001 addgene
    J Cell 2012 11 001 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2012+addgene+plasmid/pNN10+(Plasmid+%2331016)/10__7554_slash_elife__92189__3-276-0-1
    Average 92 stars, based on 1 article reviews
    j cell 2012 11 001 addgene - by Bioz Stars, 2026-09
    92/100 stars
    		  Buy from Supplier
    nta 2012 zp568 aav pef1a flex ha vhh kash wpre addgene  (Addgene inc)
    93
    Addgene inc nta 2012 zp568 aav pef1a flex ha vhh kash wpre addgene
    Nta 2012 Zp568 Aav Pef1a Flex Ha Vhh Kash Wpre Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2012+addgene+plasmid/AAV-pEF1a-FLEX-HA-VHH-KASH-WPRE+(Plasmid+%23129704)/pm38215742-477-105-107
    Average 93 stars, based on 1 article reviews
    nta 2012 zp568 aav pef1a flex ha vhh kash wpre addgene - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    2012 addgene 53249 october  (Addgene inc)
    92
    Addgene inc 2012 addgene 53249 october
    2012 Addgene 53249 October, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2012+addgene+plasmid/pCAG-T7-TALEN(Sangamo)-Destination+(Plasmid+%2337184)/us11781173-366-0-1
    Average 92 stars, based on 1 article reviews
    2012 addgene 53249 october - by Bioz Stars, 2026-09
    92/100 stars
    		  Buy from Supplier
    2012 n a pcag ecas9 gfp u6 grna addgene 79145 pcag ecas9 gfp u6 mints11 grna  (Addgene inc)
    94
    Addgene inc 2012 n a pcag ecas9 gfp u6 grna addgene 79145 pcag ecas9 gfp u6 mints11 grna
    2012 N A Pcag Ecas9 Gfp U6 Grna Addgene 79145 Pcag Ecas9 Gfp U6 Mints11 Grna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2012+addgene+plasmid/pCAG-eCas9-GFP-U6-gRNA+(Plasmid+%2379145)/pm36309014-293-48-51
    Average 94 stars, based on 1 article reviews
    2012 n a pcag ecas9 gfp u6 grna addgene 79145 pcag ecas9 gfp u6 mints11 grna - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    2012 addgene  (Addgene inc)
    96
    Addgene inc 2012 addgene
    2012 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2012+addgene+plasmid/lentiCas9-Blast+(Plasmid+%2352962)/pm36044842-251-137-138
    Average 96 stars, based on 1 article reviews
    2012 addgene - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    2012 n a pspax2 didier trono addgene  (Addgene inc)
    98
    Addgene inc 2012 n a pspax2 didier trono addgene
    2012 N A Pspax2 Didier Trono Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2012+addgene+plasmid/psPAX2+(Plasmid+%2312260)/pm36044856-264-218-223
    Average 98 stars, based on 1 article reviews
    2012 n a pspax2 didier trono addgene - by Bioz Stars, 2026-09
    98/100 stars
    		  Buy from Supplier
    2012 addgene plasmid  (Addgene inc)
    94
    Addgene inc 2012 addgene plasmid
    2012 Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2012+addgene+plasmid/pUltra+(Plasmid+%2324129)/pm35649379-265-30-40
    Average 94 stars, based on 1 article reviews
    2012 addgene plasmid - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier

    Image Search Results